Molecular Biology Techniques MCQ Quiz - Objective Question with Answer for Molecular Biology Techniques - Download Free PDF
Last updated on Mar 11, 2025
Latest Molecular Biology Techniques MCQ Objective Questions
Molecular Biology Techniques Question 1:
A student was asked to clone a DNA fragment, flanked by BamHI (GGATCC) sites into a vector, cut with Bglll (AGATCT). The cloning was successful, as these two restriction enzymes are known to create compatible sites. Based on this, what will be the restriction site configurations of these two enzymes (indicates the point of enzymatic cleavage).
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 1 Detailed Solution
The correct answer is G/GATCC and A/GATCT
Explanation:
- Restriction enzymes are proteins that recognize specific, short nucleotide sequences in DNA and cleave the DNA at or near these sites.
- BamHI and BglII are restriction enzymes that recognize different sequences but produce compatible cohesive (sticky) ends, allowing for the successful cloning of DNA fragments between these sites.
- BamHI recognizes the sequence GGATCC and cuts between the G and GATCC, creating a 5' overhang.
- BglII recognizes the sequence AGATCT and cuts between the A and GATCT, also creating a 5' overhang compatible with the BamHI cut site.
Other Options:
- G/GATCC and AGATC/T - Incorrect. While G/GATCC is the correct cleavage site for BamHI, AGATC/T is not a correct representation of the BglII cleavage site. BglII cleaves between the A and GATCT, not AGATC/T.
- GGATC/C and A/GATCT - Incorrect. GGATC/C misrepresents the BamHI cleavage site, which should be G/GATCC.
- GGATC/C and AGA/TCT - Incorrect. Both cleavage sites are incorrect here. BamHI should be G/GATCC and BglII should be A/GATCT.
Molecular Biology Techniques Question 2:
Which of the following methods would typically NOT be used to assess apoptosis in cultured mammalian cells?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 2 Detailed Solution
The correct answer is PCR for gene expression
Explanation:
Apoptosis, or programmed cell death, can be studied using various biochemical and imaging techniques. Each method provides insights into specific molecular or cellular aspects of apoptosis.
- Annexin V staining: Annexin V binds to phosphatidylserine, a phospholipid normally found on the inner leaflet of the plasma membrane. During apoptosis, phosphatidylserine is translocated to the outer leaflet, where Annexin V can bind. This method is widely used in flow cytometry or fluorescence microscopy to detect early apoptotic cells.
- TUNEL assay: The TUNEL (Terminal deoxynucleotidyl transferase dUTP Nick End Labeling) assay detects DNA fragmentation, a hallmark of apoptosis. The method labels the free 3'-OH ends of fragmented DNA using terminal deoxynucleotidyl transferase. This is a reliable technique for identifying late-stage apoptotic cells.
- Western blot for caspase cleavage: Apoptosis involves the activation of caspases, which are proteolytic enzymes. Detection of cleaved caspase products (e.g., cleaved caspase-3 or PARP) is a definitive indicator of apoptosis. Western blotting is commonly used to study these protein modifications.
- PCR for gene expression: While PCR (Polymerase Chain Reaction) can be used to measure the expression of genes involved in apoptosis (e.g., Bax, Bcl-2, or caspases), it only provides indirect evidence of apoptosis. PCR does not measure the actual apoptotic process or associated biochemical changes such as DNA fragmentation, caspase activation, or phosphatidylserine exposure.
In Summary,
Method | Principle/Target | Applicability to Apoptosis Study |
Annexin V staining | Detects phosphatidylserine translocation | Direct, early apoptosis detection |
TUNEL assay | Detects DNA fragmentation | Direct, late apoptosis detection |
Western blot | Detects cleaved caspases/PARP | Direct, measures apoptosis markers |
PCR | Measures gene expression | Indirect, not specific to apoptosis progression |
Molecular Biology Techniques Question 3:
The melting temperature (Tm) for an A-T pair is 2°C, and for a G-C pair is 4°C. Calculate the total melting temperature of the following DNA sequence:
AAGGCTTAGGCTA
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 3 Detailed Solution
The correct answer is 38°C
Explanation:
Primer melting temperature (Tm) :
- All primers in the reaction must have a similar melting temperature (Tm) so they anneal to and dissociate from complementary DNA sequences at approximately the same temperatures, allowing each amplification to precede at the selected temperature.
- Primer melting temperature (Tm) by definition is the temperature at which one half of the DNA duplex will dissociate to become single stranded and indicates the duplex stability.
- Primers with melting temperatures in the range of 52-58°C generally produce the best results.
- Primers with melting temperatures above 65°C have a tendency for secondary annealing.
- The guanine-cytosine (GC) content of the sequence gives a fair indication of the primer Tm.
- The melting temperature is influenced by the base composition because G-C pairs, with three hydrogen bonds, are stronger and require more energy to separate compared to A-T pairs, which have two hydrogen bonds.
The formula for primer Tm calculation: Tm = [4(G + C) + 2(A + T)] °C
Molecular Biology Techniques Question 4:
Given below is a DNA sequence:
5' – TCGGACTTAGCGTACGATGCTAGTACGGCAT 3'
In the absence of any other affecting parameters such as length, Tm, or GC content, which one of the following pairs of primers would successfully amplify the above DNA fragment?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 4 Detailed Solution
The correct answer is 5' TCGGACTT 3' and 5' ATGCCGTA 3'
Explanation:
- PCR primers must anneal to the complementary strands of the DNA.
- Forward primer binds to the template strand, moving from 3' to 5'. It attaches to the start codon of the template DNA.
- Reverse primer binds to the coding strand, running from 5' to 3'. It attaches to the stop codon of the complementary strand of DNA.
- The primers must extend toward each other, ensuring amplification of the region between them.
- The forward primer matches the 5' end of the given strand.
- The reverse primer matches the reverse complement of the 3' end.
5' TCGGACTT 3' and 5' ATGCCGTA 3'
Forward primer: 5' TCGGACTT 3'
- This sequence matches the 5' end of the provided DNA strand, making it a valid forward primer.
Reverse primer: 5' ATGCCGTA 3'
- This sequence matches the reverse complement of the 3' end of the given strand (complement of 5' TACGGCAT 3').
Therefore, the correct answer is Option 2
Molecular Biology Techniques Question 5:
In 'TaqMan' assay for detection of base substitutions (DNA variant), probes (oligonucleotides) with fluorescent dyes at the 5'-end and a quencher at 3'-end are used. While the probe is intact, the proximity of the quencher reduces the fluorescence emitted by reporter dye. If the target sequences (wild type or the variant) are present, the probe anneals to the target sequence, downstream to one of the primers used for amplifying the DNA sequence flanking the position of the variants. For an assay two flanking PCR primers, two probes corresponding to the wild type and variant allele and labelled with two different reporter dyes and quencher were used. During extension the probe may be cleaved by the Taq-polymerase separating the reporter dye and the quencher. Three individuals were genotyped using this assay. Sample for individual I shows maximum fluorescence for the dye attached to the wild type probe, sample for individual II shows maximum fluorescence for the dye attached to variant probe and sample for individual III exhibits equal fluorescence for both the dyes. Which of the following statement is correct?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 5 Detailed Solution
The correct answer is Individual II is homozygous for variant allele.
Explanation:
- Each individual was tested using two different probes: one for the wild type allele (with its specific reporter dye) and one for the variant allele (with a different reporter dye).
- Fluorescence is generated when the Taq polymerase cleaves the probes during the PCR, separating the reporter dye from the quencher, thus allowing the dye to fluoresce.
Individual I shows maximum fluorescence for the dye attached to the wild type probe.
- This means that Individual I has the wild-type allele because the probe specific to the wild-type allele is binding to the DNA and being cleaved by the Taq polymerase, generating strong fluorescence for the wild type dye.
- Therefore, Individual I is homozygous for the wild type allele.
Individual II shows maximum fluorescence for the dye attached to the variant probe.
- This means that Individual II has the variant allele because the probe specific to the variant allele is binding to the DNA and being cleaved by the Taq polymerase, generating strong fluorescence for the variant dye.
- Therefore, Individual II is homozygous for the variant allele.
Individual III exhibits equal fluorescence for both the dyes.
- This means that Individual III has both the wild type and the variant alleles because both probes are binding to the DNA and being cleaved by the Taq polymerase, leading to equal fluorescence from both the wild type and variant dyes.
- Therefore, Individual III is heterozygous, having one wild type allele and one variant allele.
Top Molecular Biology Techniques MCQ Objective Questions
Which one of the following regions of the target gene is NOT used for making an RNAi construct to knock down its expression?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 6 Detailed Solution
Download Solution PDFConcept:
- RNA interference (RNAi) is considered as an evolutionary mechanism of gene regulation.
- Gene regulation is induced by small silencing RNA in a sequence-specific manner.
- Small interfering RNA (siRNA) and micro RNA(mi RNA) are central to RNA interference.
- In siRNA mediated RNAi pathway, dsRNAs are processed into siRNA duplexes comprised of two ~21 nucleotides long strands with overhangs at the 3' ends by an enzyme called Dicer.
- miRNA binds to 3'-UTR of specific mRNAs to regulate gene expression post-transcriptionally.
Explanation:
- RNAi, a kind of RNA silencing mechanism, is a sequence-specific degradation of RNA induced by long double-stranded RNA
- Because intronic sections frequently lack complementary sequences to the target mRNA, they are not employed to create RNAi constructs to inhibit gene expression.
- When a double-stranded RNA is introduced into a cell, it is converted into a small interfering RNA (siRNA), which targets particular mRNAs for degradation.
- To successfully destroy the target mRNA, the siRNA must contain a complementary sequence to it.
- Intronic sections lack a corresponding sequence to the target mRNA because they are transcribed but not translated into proteins.
Additional points:
- Recent studies provides information that the exonic si-RNA mediated gene silencing regulates sexula reproduction in fungus Fusarium graminearum.
- Intronic miRNA is a new class of miRNAs derived from the processing of gene introns.
Conclusion:-
So, the correct answer is Intronic region.
The ColE1 plasmid has a low to medium copy number. However, pUC18, which is also a ColE1- based plasmid, has a high copy number because:
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 7 Detailed Solution
Download Solution PDFThe correct answer is Option 2 i.e.It has a mutation in RNAII (primer for replication initiation) and does not carry the rop gene
Concept:
- Plasmids are extra-chromosomal present in bacteria.
- They are small double-stranded DNA molecule that is usually circular in shape.
- They can exist independently of the host chromosomes, meaning they can auto-replicated.
- They are present majorly in bacteria but they are also found in yeast and some fungi.
- They have their own replication origin to initiate replication and hence are auto-replicable and can be inherited stably.
- Plasmids only have a few genes as compared to the genomic DNA of the bacteria.
- Also, genetic information in the plasmid is not essential for the survival of the host. Bacteria that lack plasmid usually function normally.
Explanation:
- Replication of ColEl-type plasmids is regulated by two main factors - RNAI and RNAII.
- RNA I is plasmid-specific RNA (RNA I) and it binds to the transcript (RNA II) from the primer promoter resulting in the inhibition in the formation of the primer required for DNA replication.
- So, if RNAII is mutated then RNAI cannot bind to it and it connects and stops DNA replication initiation in the bacteria.
- The repressor of primer (Rop) is a small dimeric protein that plays an important role in the mechanism of controlling the copy number of plasmid by increasing the affinity between two complementary RNAs.
- pUC18 does not have Rop protein.
- Rop protein is a negative regulator of plasmid replication.
- So, if it is removed then it will 'loosen the control' on plasmid replication leading to increased copy number.
- So, pUC18 have a high copy number because both of the above condition is fulfilled i.e., mutation in RNAII and absence of Rop.
Hence, the correct answer is Option 2 i.e. It has a mutation in RNAII (primer for replication initiation) and does not carry the rop gene .
Given below are a few terms related to map‐based sequencing of genomes:
A. Partial digestion with restriction enzymes.
B. Assembly of contigs
C. Pulsed field gel electrophoresis
D. Cloning in cosmids/YACs/BACs
E. Sub‐cloning and sequencing
Which one of the following options represents the correct order of steps (based on the above terms) in map‐based sequencing?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 8 Detailed Solution
Download Solution PDFConcept:
- The creation of progressively detailed maps of each human chromosome is one of the main objectives of the Human Genome Project.
- Finding the base sequence of each of the ordered DNA fragments comes after mapping is complete.
- Finding every gene in the DNA sequence and creating tools to use this knowledge in the study of human biology and medicine are the ultimate goals of genome research.
Explanation:
- Chromosomes are first broken up into manageable pieces for propagation and characterization, and then they are ordered (mapping) to correspond to their specific places on the chromosomes.
Steps -
- Pulsed field gel electrophoresis: The DNA fragments are separated based on their size using a technique called pulsed field gel electrophoresis (PFGE). PFGE is a specialized gel electrophoresis method that allows for the separation of large DNA fragments.
- Partial digestion with restriction enzymes: In this step, the DNA of interest is partially digested using restriction enzymes. This process results in the creation of DNA fragments of varying lengths.
- Cloning in cosmids/YACs/BACs: The separated DNA fragments are then cloned into vectors such as cosmids, YACs (yeast artificial chromosomes), or BACs (bacterial artificial chromosomes). These vectors can accommodate large DNA fragments and serve as carriers for the cloned fragments
- Assembly of contigs: The cloned fragments are further analyzed and arranged in the correct order to reconstruct the original DNA sequence. This process involves comparing overlapping regions of the cloned fragments and assembling them into contigs, which are contiguous sequences of DNA.
- Sub-cloning and sequencing: Once the contigs are formed, specific regions of interest are selected for further analysis. The selected regions are sub-cloned into smaller vectors and subjected to DNA sequencing. The DNA sequencing process determines the precise nucleotide sequence of the sub-cloned fragments, providing detailed information about the genome being sequenced.
Therefore, the correct answer is C-A-D-B-E.
The pI of four proteins (A, B, C, D) are shown in the table below:
Protein | pI |
A | 4 |
B | 5.5 |
C | 7 |
D | 9 |
To purify ‘D’ from a mixture of these four proteins in a single step, using ion‐exchange chromatography, what combination of buffer pH and ion‐exchange resin would you select?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 9 Detailed Solution
Download Solution PDFConcept:-
- Based on their affinity for ion exchangers, ions and polar compounds can be separated using ion exchange chromatography (also known as ion chromatography).
- Thus, the reversible exchange of ions between the target ions in the sample solution and the ions on the ion exchangers constitutes the separation principle.
- Positively charged ions will be drawn to cationic exchangers with negatively charged groups. Because their negative charges originate from the ionization of acidic groups, these exchangers are also known as "Acidic ion exchange" materials.
- Positively charged ions will be drawn to negatively charged anions by anionic exchangers. Also known as "Basic ion exchange" materials, these.
- The
isoelectric point (pI) is the pH value at which the molecule carries no electrical charge. - The concept is particularly important for zwitterionic molecules such as amino acids, peptides, and proteins.
Explanation:-
Option:- pH 8, cation exchanger resin
- If pH>pI then it exhibits a net negative charge and binds to an anion exchanger.
- If pH=pI then no net charge and no binding to the ion exchanger.
- And if pH
- Here, pH is less than pI, and if pH
- Here, pH is less than pI, and if pH
Conclusion:-
Hence, the pH 8, cation exchanger resin is correct.
The mouse homozygous null mutant for a gene bfg always dies mid-gestation. Chimeric mice made of bfg null cells and wild-type cells have healthy pups. When the developing brain of these pups is examined, they have more than two hippocampi. Closer examination reveals bfg null cells at the centre of these supernumerary hippocampi.
Which of the following inferences can correctly be drawn from this experiment?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 10 Detailed Solution
Download Solution PDFThe correct answer is Wild type bfg function in the developing brain suppresses hippocampus specification in neighbouring cells.
Concept:
- The key observation in the experiment is the formation of supernumerary (extra) hippocampi in chimeric mice that contain both bfg-null cells and wild-type cells. The bfg-null cells are specifically found at the center of these extra hippocampi
- This suggests that in the absence of bfg function (i.e., in the bfg-null cells), extra hippocampi are being formed. This implies that the wild-type bfg gene normally suppresses or inhibits the formation of additional hippocampi.
- In other words, wild-type bfg function prevents the over-specification or over-formation of hippocampal structures. When the bfg function is absent (in bfg-null cells), this suppression is lost, leading to the formation of extra hippocampi around those null cells.
- The fact that bfg-null cells are located at the center of these extra hippocampi suggests that the absence of bfg allows hippocampus specification to occur around them. This indicates a non-cell-autonomous function where wild-type bfg suppresses hippocampal formation in neighboring cells.
Explanation:
Based on the experiment involving the bfg homozygous null mutant mice and the chimeric mice with both bfg null and wild-type cells, we can analyze the potential inferences:
Summary of Key Findings:
- Homozygous Null Mutant: Mice lacking the bfg gene die mid-gestation, indicating that bfg is essential for survival at this stage.
- Chimeric Mice: The presence of both bfg null and wild-type cells in chimeric mice leads to the birth of healthy pups.
- Supernumerary Hippocampi: The pups have more than two hippocampi, with bfg null cells located at the center of these extra structures.
Analysis of Inferences:
-
Wild-type bfg function in the developing brain induces hippocampus specification in neighboring cells.
- Incorrect. The experiment shows that in the absence of bfg, hippocampal structures form around bfg-null cells. This suggests that bfg normally suppresses, not induces, hippocampal formation.
-
Wild-type bfg function in the developing brain suppresses hippocampus specification in neighboring cells.
- Correct. The formation of extra hippocampi in the absence of bfg (in bfg-null cells) indicates that wild-type bfg plays a role in suppressing the over-specification of hippocampal structures. The wild-type cells are influencing neighboring bfg-null cells, showing that the gene's effect is not limited to the cells in which it is expressed, but affects surrounding cells.
-
bfg function is completely cell autonomous.
- Incorrect. The presence of wild-type cells is crucial for the healthy development of the pups. If bfg function were entirely cell autonomous, we wouldn't see any effect from the neighboring wild-type cells.
-
bfg function is hippocampus specific.
- Incorrect. There’s no evidence provided in the experiment that suggests bfg function is limited only to the hippocampus. The lethality of the null mutants indicates a broader role in development.
Given below are some statements with blank spaces indicated by '_________'.
A. A plasmid cloning vector digested with an enzyme (with a single restriction site in the plasmid) that generates 3' overhangs can be made blunt-ended using _________.
B. DNA with a nucleotide composition of 30% A, 35% G, 20% C and 15% T is most likely _________.
C. Production of only truncated molecules of transgene-derived mRNA in transgenic plants generated using a transgene from a prokaryotic source is most likely due to _________.
D. _________ is a method for identifying the positions where individual DNA-binding proteins attach to a genome.
Which one of the following options has the correct sequence of terms that can be used to complete the above statements (from A to D) such that all statements become true?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 11 Detailed Solution
Download Solution PDFImportant Points
Statement A-
- When performing cloning, researchers often use restriction enzymes to cut the DNA at specific sites.
- However these enzymes may leave overhanging ends or "sticky ends" that can lead to undesirable cloning results.
- Mung bean nuclease helps address this issue by removing these unwanted overhang, resulting in a blunt-ended DNA fragments.
- By using mung bean nuclease to generate blunt ends, researchers can enhance the success rate of their cloning experiments and facilitate the insertion of DNA fragments into vectors for further analysis.
Statement B-
- Since single stranded DNA can have any nucleotide composition, there is no fixed composition for all single stranded DNA molecules.
- The percentage of each nucleotide in a single stranded DNA molecule would depend on the specific sequence of bases in that particular strand.
- The given composition is- 30%A, 35%G, 20%C and 15%T
- If this is a double stranded DNA ,so there must be 30% T with 30%A because in double stranded DNA there is equal amount of adenine and thymine and similarly equal amount of guanine and cytosine. So the base composition for a double stranded DNA would be 30%A with 30%T and 20%C with 20%G.
Statement C-
- In prokaryotic DNA, however lacks polyadenylation signals, as bacteria do not utilize the same polyadenylation process as eukaryotes.
- When a prokaryotic transgene is introduced into a eukaryotic plant, it may not contain the necessary signals for proper polyadenylation and processing of m-RNA.
- As a result, the transgene derived mRNA produced in the transgenic plant may lack a polyadenine tail.
- This leads to the production of truncated mRNA molecule which are unstable and might be rapidly degraded within the cell.
Statement D-
- ChIP-seq stands for Chromatin Immunoprecipitation followed by sequencing.
- It is powerful technique used in molecular biology and genomics to study protein-DNA interaction in cells.
- It is a method for identifying the positions where individual DNA binding proteins attach to a genome.
Hence, the correct answer is option 3 i.e. A - Mung bean nuclease; B - single-stranded; C - presence of potential poly-adenylation signals in the transgene sequence; D - ChIP - seq.
Given below are the approximate lengths of DNA fragments obtained on agarose gel electrophoresis following restriction digestion of a 3kb circular plasmid with different restriction
enzymes:
BamHI : 0.5kb, 2.5kb
HincII : 3 kb
EcoRI : 3 kb
EcoRI + BamHI : 0.5kb, 1kb, 1.5kb
EcoRI + HincII : 3kb, 1.7kb
BamHI + HincII : 0.2kb, 0.3kb, 2.5kb
Based on the above information, which one of the following statements is INCORRECT?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 12 Detailed Solution
Download Solution PDFConcept:
- Restriction enzymes are endonucleases that cleave nucleic acid.
- It is a bacterial enzyme that cleaves the double stranded DNA by cleaving the phosphodiester bonds at a specific nucleotide sequence. This enzyme restrict the entry of foreign DNA in the bacteria. hence, restriction enzyme is evolved to resist against the viral attack.
- Following are the characteristics of restriction enzymes:
- Restriction enzyme recognises the restriction site sequence that are palindromes.
- Restriction enzyme recognise restriction sites irrespective sources.
- Restriction enyzmes are highly specialise as they only recognise one restriction site.
- Restriction endonuclease are categorised into three general groups - Type I, II, and III.
- Restriction enzyme type I - it is bifunctional enzyme as it has both endonuclease and methulase activity. It consists of three different subunits. It make cut almost 1000bp away from the restriction site.
- Restriction enzyme type II - it is unifunctional enzyme with endonuclease activity, it consists of two identical subunits, it cut DNA at or near the restriction sites.
- Restriction enzyme type III - it is bifunctional enzyme with both endonuclease and methylase activity, it consists of two subunits, and it cut DNA at 24-26 bp 3' to that of its restriction sites.
Explanation:
Based on the information provided, the following is the map of the plasmid.
Option 1:
- Both HincII and EcoRI only produce one fragment of the DNA on the agarose gel.
- Since the plasmid is circular it it is cut at a single location it will only produce one single fragment, also the length of the fragment will be equal to that of the plasmid.
- So, this statement is correct.
Option 2:
- BamHI produces two fragments of lengths 0.5kb and 2.5kb.
- Since the plasmid DNA is circular and restriction digestion with BamHI produces two fragments we can say that the plasmid has two BamHI sites.
- Now when the plasmids were digested with two restriction enzymes i.e., BamHI + HincII then three fragments were created of lengths 0.2kb, 0.3kb, and 2.5kb.
- Now if we compare the fragments produced by only BamHI and that of BamHI + HincII, we see that a 2.5kb fragment is present in both cases, but 0.5 fragments are divided to produce 0.3 and 0.2 fragments when HincII is used along with BamHI, so we can conclude that HincII restriction site is present between two BamHI sites.
- Hence, this statement is correct.
Option 3:
- The distance between the BamHI and HincI restriction sites is less compared to the distance between HincI and BamHI as we can see in the plasmid map.
- Hence, this statement is incorrect.
option 4:
- HincI restriction site is near to BamHI restrictions sites as compared to that of EcoRI.
- The distance between BamHI and HincI is 0.2kb. while the distance between HincI and EcoRI is 1.3kb.
- Hence, this statement is correct.
Hence, the correct answer is option 3 i.e. The distance between EcoRI and BamHI sites is less than that between the HincII site and BamHI sites..
Inverse PCR is performed for site‐directed mutagenesis with complementary primers (having the desired mutation) using a plasmid having the cloned gene as template. The following statements were made regarding the above experiment.
A. PCR is followed by transformation of bacterial cells directly with the reaction mixture. A large number of the transformants will have the wild type gene.
B. The PCR mixture is treated with Dpn I and then used to transform bacterial cells. Most of the transformants will have the mutant gene.
C. PCR is followed by transformation of bacterial cells directly with the reaction mixture. None of the transformants will have the mutant gene.
D. The PCR mixture is treated with Dpn I and then used to transform bacterial cells. Half of the transformants will have the mutant gene.
Which one of the following options represents a combination of all correct statements?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 13 Detailed Solution
Download Solution PDFConcept:
- Using primers pointed in the other direction, inverse PCR enables the amplification of an unidentified sequence area.
- This approach can be modified to insert mutations into sequences that have already been cloned.
- A full circular plasmid is amplified to delete, substitute, or insert the required sequence using primers that incorporate the intended alteration.
- The extremely adaptable method of site-directed mutagenesis can be used to insert particular nucleotide substitutions (or deletions) in a targeted manner.
Explanation:
Statement A:- CORRECT
- After amplification, the DNA strands in the PCR reaction mixture will be a mixture of native, nonmutated, methylated DNA strands and mutant, unmethylated DNA strands.
- The bacteria will use a mismatch repair process that uses the methylated DNA strand as a reference to rectify the mismatch when this mixture is directly delivered into the bacterial cell.
- Since the mutant strands were created during PCR and are therefore unmethylated, the mismatch repair system will be able to correct them, resulting in a significant number of transformants carrying the wild-type gene.
Statement B:- CORRECT
- To solve the aforementioned issue, methylated template DNA is removed from the nonmethylated PCR product by DpnI digestion after PCR amplification using inverse primers.
- PCR product is then phosphorylated by polynucleotide kinase before being recircularized by ligation and transformed into E. coli.
- Large numbers of transformants containing the mutant gene are produced as a result.
Statement C:- INCORRECT
- PCR is followed by the transformation of bacterial cells directly with the reaction mixture. A large number of the transformants will have the wild-type gene.
Statement D:- INCORRECT
- The PCR mixture is treated with Dpn I and then used to transform bacterial cells. Most of the transformants will have the mutant gene.
Therefore the correct answer is option A ( A and B ).
Molecular Biology Techniques Question 14:
RFLP and RAPD markers are commonly used in plant breeding and diversity analysis. Which of the following combination of statement about these molecular makers are correct?
A. RFLP is co dominant
B. RAPD is co dominant
C. Both the markers are ubiquitous
D. Only RFLP can detect heterozygote
E. Only RAPD can detect heterozygote
F. RAPD cannot detect allelic variation
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 14 Detailed Solution
Concept:
- The use of genetic markers has significantly advanced plant breeding.
- The genetic marker is a gene or DNA sequence that controls a certain gene or trait and has a known chromosome position.
- The two main categories of genetic markers are classical markers and DNA/molecular markers.
- Classical markers include morphological, cytological, and biochemical ones.
- DNA markers include single-nucleotide polymorphism (SNP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSRs), restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), random amplified polymorphic DNA (RAPD) and diversity arrays technology (DArT) markers.
- Restriction fragment length polymorphism (RFLP) and random amplified polymorphic DNA (RAPD) markers are being used widely for evaluating genetic relationships of crop germplasm.
- Differences in the properties of these two markers could result in different estimates of genetic relationships among some accessions.
Explanation:
Statement A: RFLP is co dominant
-
RFLP, as a molecular marker, is specific to a single clone/restriction enzyme combination.
-
Most RFLP markers are co-dominant (both alleles in heterozygous sample will be detected) and highly locus-specific. Thus this statement is true.
Statement B: RAPD is co dominant
- RAPD markers are DNA fragments from PCR amplification of random segments of genomic DNA with single primer of arbitrary nucleotide sequence.
- Nearly all RAPD markers are dominant, i.e. it is not possible to distinguish whether a DNA segment is amplified from a locus that is heterozygous (1 copy) or homozygous (2 copies).Thus this statement is not true.
Statement C: Both the markers are ubiquitous
- Ubiquitous simply means something that is present everywhere
- RFLP is a method that takes advantage of differences in homologous DNA sequences, also referred to as polymorphisms, to identify individuals, populations, or species or to locate the positions of genes within a sequence.
- The polymerase chain reaction (PCR) method known as RAPD which is pronounced "rapid," amplifies DNA segments at random.
- The researcher performing RAPD constructs a number of arbitrary, brief primers (10–12 nucleotides), then conducts the PCR using a substantial genomic DNA template in the hopes that fragments may amplify. An RAPD response can yield a semi-unique profile by resolving the ensuing patterns.
- from the explanation above, this statement is true
Statement D: Only RFLP can detect heterozygote
- Only RFLP can detect heterozygote, thus this statement is true.
Statement E:Only RAPD can detect heterozygote
- Only RFLP can detect heterozygote as in RAPD technique it is not possible to distinguish whether a DNA segment is amplified from a locus that is heterozygous (1 copy) or homozygous (2 copies) thus this statement is not true.
Statement F: RAPD cannot detect allelic variation.
- As in RAPD technique it is not possible to distinguish whether a DNA segment is amplified from a locus that is heterozygous (1 copy) or homozygous (2 copies) thus this statement is true.
thus the correct answer is option 3 A, C, D, F.
Molecular Biology Techniques Question 15:
PCR based DNA amplification is an essential feature of which of the following combination of molecular markers?
Answer (Detailed Solution Below)
Molecular Biology Techniques Question 15 Detailed Solution
Explanation
A comparison among some of the different DNA markers used in genetic mapping
Feature | DNA Marker | |||
RFLP | RAPD | AFLP | STS | |
Efforts to generate marker | Moderate | Simple | Simpler than RFLPs | Difficult |
Ease in use | Difficult | Easy | Moderate | Moderate |
Number of markers scorable per cross | Unlimited | Unlimited | Unlimited | Unlimited |
Plant material required | Medium | Little | Medium | Little |
Reproducibi lity | High | Moderate | High | High |
Use of radioactivity | Yes | No | Yes/No | No |
Use of restriction enzymes | Yes | No | Yes | No |
Use of PCR | No | Yes | Yes | Yes |
Dominance | Codominant | Dominant | Codominant | Codominant/Dominant |
Information generated | Moderate to high | High | Very high | Very high |
Time required for detection | Relatively longer | Short | Short | Short |